Sensitive marker of the cisplatin-DNA interaction: X-ray photoelectron spectroscopy of CL

Fangxing Xiao, Xiaobin Yao, Qianhong Bao, Danzhen Li, Yi Zheng*

*Corresponding author for this work

Research output: Contribution to journalJournal Articlepeer-review

Abstract

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

Original languageEnglish
Article number649640
JournalBioinorganic Chemistry and Applications
Volume2012
DOIs
Publication statusPublished - 2012
Externally publishedYes

UN SDGs

This output contributes to the following UN Sustainable Development Goals (SDGs)

  1. SDG 3 - Good Health and Well-being
    SDG 3 Good Health and Well-being

Fingerprint

Dive into the research topics of 'Sensitive marker of the cisplatin-DNA interaction: X-ray photoelectron spectroscopy of CL'. Together they form a unique fingerprint.

Cite this