Skip to main navigation Skip to search Skip to main content

Structural study of G-quadruplexes formed by human telomeric sequences and chicken replication origin

  • Haitao MIAO

Student thesis: Doctoral thesis

Abstract

Human telomeric DNA sequences can fold into different G-quadruplex structures under physiological conditions. Human telomeric DNA sequences are involved in telomere end protection and telomeric DNA metabolism. Although many of these structures have been solved, the chair-type G-quadruplex structure remains elusive. Here, we introduce a G-quadruplex structure adopted by the human telomeric sequence htel21 d[(GGGTTA)3GGG] and its variant d[(GGGTTA)2GGGTTTGGG], htel21T18 in K+ solution. Initially, we determined the structure of htel21T18, a three-layer chair-type G-quadruplex linked by three edgewise loops. Next, a double dG to 8Br-dG substitution at positions 8 and 20 has enabled us to drive the population of G-quadruplexes formed by htel21 to predominance of a similar chair-type fold. In both chair-type G-quadruplexes, all loops are edgewise; glycosidic conformation of guanines is syn•anti•syn•anti around each tetrad, and each strand of the core has two antiparallel neighboring strands. Bioinformatics studies have shown localizations of htel21T18 and its repeats in subtelomeric regions of human chromosomes 8, 11, 17, and 19 as well as in subtelomeric region of chromosome 5. Also, we introduce a crystal structure formed by the human telomeric sequence d[GGGTTAGG8GTTAGGGTTAGG20G] with two dG to 8Br-dG substitutions at positions 8 and 20 in the K+ solution. It folds into a three-layer chair-type G-quadruplex with three linking TTA loops. Especially, T5, T17 bases and two water molecules are in the same plane and stack on a G-quartet layer. There is also a K+ ion sandwiched between the two layers, coordinating with the surrounding atoms. While a twisted Hoogsteen A12•T10 base pair covers on the top of G-quartet core. The three connecting TTA loops are edgewise and each DNA strand has two antiparallel neighboring strands. Our result expands the notion of conformational heterogeneity of human telomeric DNA as well as their single-residue loop mutants. Our findings also contribute to having a deeper understanding of loops and water molecules in the folding pathway of the G-quadruplex structures. G-quadruplexes have been found in the functionally significant regions of the genome and can regulate multiple biological processes such as DNA replication in vivo. Especially, it has been known that mouse, Drosophila and human replication origins contain special G-rich motifs termed as origin G-rich repeated elements (OGRE) which have the potential to form G-quadruplex. However, the topology of G-quadruplex adopted by OGRE still remains elusive. Here, for the first time we report the (3+1) hybrid G-quadruplex formed by OGRE located in the β-globin replication origin of chicken (Gallus gallus), a 23bp DNA sequence d [GGGAACGCGGCATCAGGGTGGGG] termed as ChickOG23. Our results show that ChickOG23 adopts a (3+1) hybrid, intramolecular, three-layered G-quadruplex topology with unique structural features including a cytosine-bulge. Furthermore, our findings shed light on the importance of G4s in the DNA replication and may serve as a potential target for drug delivery, biological target detection and structure based anti-cancer drug design.
Date of Award2020
Original languageEnglish
Awarding Institution
  • The Hong Kong University of Science and Technology

Cite this

'